YuuMJ1997/EukPhylo
1
0
Fork 0
mirror of http://43.156.76.180:8026/YuuMJ/EukPhylo.git synced 2025-12-28 21:00:25 +08:00
Code Issues Packages Projects Releases Wiki Activity

Updated PhyloToL Part 1: GF assignment (markdown)

Katzlab 2024-08-14 04:39:41 -04:00
parent 3b667dc180
commit 5c84f9e84d
1 changed files with 2 additions and 2 deletions
Show Stats Download Patch File Download Diff File Expand all files Collapse all files

4
PhyloToL-Part-1:-GF-assignment.md

@ -50,7 +50,7 @@ with the first ten digits representing a unique sample identifier. Each sequence
> ATGAAGAAGGTAACTGCAGAGGCTATTTCCTGGAATGAATCAACGAGTGAAACGAATAACTCTATGGTGACTGAATTCATTTTTCTGGGTCTCTCTGATTCTCAGGAACTCCAGACCTTCCTATTTATGTTGTTTTTTGTATTCTATGGAGGAATCGTGTTTGGAAACCTTCTTATTGTCATAACAGTGGTATCTGACTCCCACCTTCACTCTCCCATGTACTTCCTGCTAGCCAACCTCTGA...
And all of the CDS fasta files should be in a folder alongside the [Scripts](https://github.com/Katzlab/PhyloToL-6/blob/main/PTL1/Genomes/Scripts) and [Databases](https://github.com/Katzlab/PhyloToL-6/blob/main/PTL1/Genomes/Databases) folders, as above.
And all of the CDS fasta files should be in a folder alongside the [Scripts](https://github.com/Katzlab/PhyloToL-6/blob/main/PTL1/Genomes/Scripts) and [Databases](https://github.com/Katzlab/PhyloToL-6/blob/main/PTL1/Genomes/Databases) folders, as described above for transcriptomes.
## Databases
@ -59,7 +59,7 @@ PhyloToL part 1 requires several reference databases used at various steps in th
<img src="https://github.com/Katzlab/PhyloToL-6/blob/main/Other/PTL1_databases_folder_structure.png" width="30%">
Inside the db_BvsE folder are two Diamond-formatted reference databases of diverse eukaryotic (eukout.dmnd) and bacterial (micout.dmnd) sequences, used for identification of putative bacterial contamination. The folder also contains a BLAST+ formatted database of rRNA sequences, used for removal of putative rRNA. The db_StopFreq folder contains one Diamond-formatted reference database of diverse eukaryotic protein sequences, used for identifying putative reading frames in the calculation of in-frame stop codon frequencies for genetic code assignment. The db_OG folder contains the Hook Database, which MUST be provided as BOTH and fasta file and a Diamond-formatted database, and these files should have the same name up to the extension.
Inside the db_BvsE folder are two Diamond-formatted reference databases of diverse eukaryotic (eukout.dmnd) and prokaryotic (micout.dmnd) sequences, used for identification of putative contamination (ultimately labeled _P for putative prokaryotic, vs _E for likely eukaryotic). These are just preliminary assignments that help users interpret data on trees, and should be treated as such. The folder also contains a BLAST+ formatted database of rRNA sequences, used for removal of putative rRNA (putative rDNAs are sequestered in a separate file called **TBD**). The db_StopFreq folder contains one Diamond-formatted reference database of diverse eukaryotic protein sequences, used for identifying putative reading frames in the calculation of in-frame stop codon frequencies for genetic code assignment (i.e for studies of ciliates and other lineages with aberant codes). The db_OG folder contains the Hook Database, which MUST be provided as BOTH and fasta file and a Diamond-formatted database, and these files should have the same name up to the extension (e.g. **TBD** Hook.fasta, Hook,dmd).
You can download these databases from the [PhyloToL Figshare page](https://doi.org/10.6084/m9.figshare.26597368). You will have to add the Hook Database to the db_OG folder manually; you can find the Hook Database [here](https://doi.org/10.6084/m9.figshare.26539753.v1). Convert it to a Diamond database and proceed. Alternatively, you can create your own reference database for gene family assignment (described below).