diff --git a/PhyloToL-Part-1.md b/PhyloToL-Part-1.md
index b895c04..b04b851 100644
--- a/PhyloToL-Part-1.md
+++ b/PhyloToL-Part-1.md
@@ -39,7 +39,18 @@ At this point, you are ready to run the code! See the [Processing transcriptomes
 
 #### Genomes
 
-PhyloToL part 1 for genomes takes as input genomic CDS, such as are available to download for many genome assemblies on GenBank
+PhyloToL part 1 for genomes takes as input genomic CDS, such as are available to download for many genome assemblies on GenBank. Similarly to the transcriptome setup above, each input file must be named in the format 
+
+>Op_me_Hsap_GenBankCDS.fasta
+
+with the first ten digits representing a unique sample identifier. Each sequence in the CDS fasta file should be formatted as downloaded from GenBank:
+
+>/>lcl|NC_000001.11_cds_NP_001005484.2_1 [gene=OR4F5] [db_xref=CCDS:CCDS30547.1,Ensembl:ENSP00000493376.2,GeneID:79501] [protein=olfactory receptor 4F5] [protein_id=NP_001005484.2] [location=join(65565..65573,69037..70008)] [gbkey=CDS]
+ATGAAGAAGGTAACTGCAGAGGCTATTTCCTGGAATGAATCAACGAGTGAAACGAATAACTCTATGGTGACTGAATTCAT
+TTTTCTGGGTCTCTCTGATTCTCAGGAACTCCAGACCTTCCTATTTATGTTGTTTTTTGTATTCTATGGAGGAATCGTGT
+TTGGAAACCTTCTTATTGTCATAACAGTGGTATCTGACTCCCACCTTCACTCTCCCATGTACTTCCTGCTAGCCAACCTC...
+
+And all of the CDS fasta files should be in a folder alongside the [Scripts](https://github.com/Katzlab/PhyloToL-6/blob/main/PTL1/Genomes/Scripts) and [Databases](https://github.com/Katzlab/PhyloToL-6/blob/main/PTL1/Genomes/Databases) folders, as above.
 
 
 ## The Hook Database