Updated PhyloToL Part 1 (markdown)

Katzlab 2024-08-09 16:24:39 -04:00
parent bf8b404d49
commit d6ab88cf13

@ -1,7 +1,11 @@
## Overview and modularity ## Overview and modularity
PhyloToL part 1 is primarily intended to assign gene families to assembled transcripts or genomic CDS, but also contains a number of quality filters and other curation steps. _More description here_
## Setup ## Setup
Below is a description of everything you need in order to start running PhyloToL part 1 on transcriptomic or genomic samples!
### Dependencies ### Dependencies
The following are required to run PhyloToL part 1. The dependencies are confirmed to work using the version numbers in parentheses, though other versions may work as well. The following are required to run PhyloToL part 1. The dependencies are confirmed to work using the version numbers in parentheses, though other versions may work as well.
@ -12,13 +16,31 @@ The following are required to run PhyloToL part 1. The dependencies are confirme
### Input data and folder structure ### Input data and folder structure
An important aspect of PhyloToL is that it controls taxon, gene family, and sequence names very carefully. PhyloToL part 1 processes input data one sample at a time, and we require that each input sample be given a ten digit code in the format Op_me_Hsap. We generally use the first two digits to represent a major clade (Opisthokonta), the second two digits to represent a minor clade (Metazoa), and the last four to represent genus and species (Homo sapiens).
#### Transcriptomes #### Transcriptomes
<img src="https://github.com/Katzlab/PhyloToL-6/blob/main/Other/PTL1_trans_foldersetup.png" width="50%"> To run PhyloToL part 1 with transcriptomic data, you need to first assemble your transcripts. We use rnaSpades, so our scripts are designed to read sequence IDs as formatted by rnaSpades. You can use your assembler of choice, but you'll need to rename your sequence IDs in the fasta file of assembled transcripts input to the pipeline. Each input fasta file of assembled transcripts ("transcripts.fasta" as output by rnaSpades) must be renamed in the format
> Op_me_Hsap_assembledTranscripts.fasta
where the first ten digits represent a variable sample identifier (see above). Each sequence in the fasta file must be named in the format
>\>NODE_40535_length_253_cov_2.87\
GTACAATATGCCTTCTTACAGTGATGAAGCTCTAACAGAAGAAAAGGTTGGATGAAAATG
GCATTATATGGTACGATTGCTGGTTTTGTTGCAGGTACAATCTTTGGATGGAAATTTAGA
AAATGGGTACAAAAT...
where the numbers after NODE_ are a unique transcript identifier, the and the following numbers representing the length and k-mer coverage, respectively. All assembled transcript files should be put into a folder called "AssembledTranscripts" (folder names are important and must be precise here and throughout). Next, download the [Scripts](https://github.com/Katzlab/PhyloToL-6/blob/main/PTL1/Transcriptomes/Scripts) and [Databases](https://github.com/Katzlab/PhyloToL-6/blob/main/PTL1/Transcriptomes/Databases) folders from this repository, and put these in the same folder as the AssembledTranscripts folder. This location is also where the Output folder containing the output of PhyloToL part 1 will be located, looking something like this
<img src="https://github.com/Katzlab/PhyloToL-6/blob/main/Other/PTL1_trans_foldersetup.png" width="30%">
At this point, you are ready to run the code! See the [Processing transcriptomes](processing-transcriptomes) section below for next steps.
#### Genomes #### Genomes
PhyloToL part 1 for genomes takes as input genomic CDS, such as are available to download for many genome assemblies on GenBank
## The Hook Database ## The Hook Database